Python - making counters, making loops?

Question

I am having some trouble with a piece of code below:

Input: li is a nested list as below:

li = [['>0123456789 mouse gene 1\n', 'ATGTTGGGTT/CTTAGTTG\n', 'ATGGGGTTCCT/A\n'],   ['>9876543210 mouse gene 2\n', 'ATTTGGTTTCCT\n', 'ATTCAATTTTAAGGGGGGGG\n']]

Using the function below, my desired output is simply the 2nd to the 9th digits following '>' under the condition that the number of '/' present in the entire sublist is > 1.

Instead, my code gives the digits to all entries. Also, it gives them multiple times. I therefore assume something is wrong with my counter and my for loop. I can't quite figure this out.

Any help, greatly appreciated.

import os

cwd = os.getcwd()


def func_one():
    outp = open('something.txt', 'w')       #output file
    li = []
    for i in os.listdir(cwd):           
        if i.endswith('.ext'):
            inp = open(i, 'r').readlines()
            li.append(inp)
    count = 0
    lis = []
    for i in li:
        for j in i:
            for k in j[1:]          #ignore first entry in sublist
                if k == '/':
                    count += 1
                if count > 1:
                    lis.append(i[0][1:10])      
                    next_func(lis, outp)

Thanks, S :-)

Answer 1

Your indentation is possibly wrong, you should check count > 1 within the for j in i loop, not within the one that checks every single character in j[1:].

Also, here's a much easier way to do the same thing:

def count_slashes(items):
    return sum(item.count('/') for item in items)

for item in li:
    if count_slashes(item[1:]) > 1:
        print item[0][1:10]

Or, if you need the IDs in a list:

result = [item[0][1:10] for item in li if count_slashes(item[1:]) > 1]

Python list comprehensions and generator expressions are really powerful tools, try to learn how to use them as it makes your life much simpler. The count_slashes function above uses a generator expression, and my last code snippet uses a list comprehension to construct the result list in a nice and concise way.